CRISPR AsCpf1 INDEL Score
(CINDEL)

CRISPR AsCpf1

Input Sequence of
CRISPR AsCpf1 INDEL (CINDEL) score

The length of an input sequence must be 27 bp.

For example, in the given sequence.

TTTA CAGTGACGTCGGTTAGGACACTG

TTTA

CAGTGACGTCGGTTAGGACACTG

PAM

23 base pair (protospacer)

  • Please note that the scores provided on this website are only for on-target activity predictions.
  • If you want to predict potential off-target sites, you can use CasOFFinder.
(We recommend selecting guide RNAs with high cindel scores and 30% - 70% GC content as the first choice.)
Copy and paste the text of a FASTA file into the text-entry area below.

(The length of input sequences must be greater than or equal to 27 bp.)

Select a FASTA file
  • Please note that the scores provided on this website are only for on-target activity predictions.
  • If you want to predict potential off-target sites, you can use CasOFFinder.
ID Position Input
Sequence
(5' → 3')
Target
Sequence
(5' → 3')
Guide RNA
Sequence
(5' → 3')
Strand GC
Contents
(%)
CINDEL
score
Note
ID Position Input
Sequence
(5' → 3')
Target
Sequence
(5' → 3')
Guide RNA
Sequence
(5' → 3')
Strand GC
Contents
(%)
CINDEL
score
Note
ID Input Sequence LINDEL score
ID Input Sequence LINDEL score