Example sequence

>JQ277699.1 Ovis aries LIN28A (LIN28A) mRNA, complete cds
ACCCCTTTGCCTCCGGACTTCTCTGGGGCCAGCAGCCGCCCAAGCGAGGGCCCGGGGCCGCGAGCTCAGC
AGACTACCATGGGCTCTGTGTCAAACCAGCAGTTCGCAGGTGGCTGCGCTAAGGCGCCGGAGGAAGCGCC
GGAGGAGGCGCCGGAGGACGCGGCCCGCGCGGCGGAGGAGCCGCAGCTGCTGCACGGTGCCGGCATCTGT
AAGTGGTTCAACGTGCGCATGGGGTTCGGCTTCCTGTCCATGACCGCCCGCGCAGGGGTCGCGCTCGACC
CCCCGGTGGATGTCTTTGTGCACCAGAGTAAGCTGCACATGGAGGGCTTCCGGAGCCTGAAGGAGGGGGA
GGCTGTGGAGTTCACCTTTAAGAAGTCCGCCAAGGGCCTGGAATCTATCCGAGTCACCGGCCCTGGTGGG
GTGTTCTGTATTGGGAGTGAAAGGCGGCCCAAAGGGAAGAATGTGCAGAAACGCAGATCAAAGGGAGACA
GGTGCTACAACTGTGGAGGTCTAGACCATCATGCCAAGGAATGCAAACTGCCACCGCAGCCCAAGAAGTG
CCATTTCTGCCAGAGCATCAGCCATATGGTAGCCTCGTGCCCACTGAAGGCCCAGCAAGCTCCCAGCTCC
CAGGGAAAGCCAGCCTACTTTCGGGAGGAGGAAGAAGAGATCCATAGCTCTGCCATGCTCCCAGAGGCCC
AGAATTGAAGCCACAGTGGGTGGGAGCTATCCTTTTGTGATCAGAAAGCTTTGAGGAGCAGCATCAATCG
CCTTTGCCTTCGGACTTCTCCGGGGCCAGCAGCCGCCCGACCAGGGGCCCGGGGCCACGGGCTCAGCCGA
CGACCATGGGCTCCGTGTCCAACCAGCAGTTTGCAGGTGGCTGCGCCAAGGCGGCAGAAGAGGCGCCCGA
GGAGGCGCCGGAGGACGCGGCCCGGGCGGCGGACGAGCCTCAGCTGCTGCACGGTGCGGGCATCTGTAAG
TGGTTCAACGTGCGCATGGGGTTCGGCTTCCTGTCCATGACCGCCCGCGCCGGGGTCGCGCTCGACCCCC
CAGTGGATGTCTTTGTGCACCAGAGTAAGCTGCACATGGAAGGGTTCCGGAGCTTGAAGGAGGGTGAGGC
AGTGGAGTTCACCTTTAAGAAGTCAGCCAAGGGTCTGGAATCCATCCGTGTCACCGGACCTGGTGGAGTA
TTCTGTATTGGGAGTGAGAGGCGGCCAAAAGGAAAGAGCATGCAGAAGCGCAGATCAAAAGGAGACAGGT
GCTACAACTGTGGAGGTCTAGATCATCATGCCAAGGAATGCAAGCTGCCACCCCAGCCCAAGAAGTGCCA